Skip to main content

Tomato Brown Rugose Fruit Virus Federal Import Order

Federal Order for U.S. Imports of tomato (Solanum lycopersicum) and pepper (Capsicum spp.) hosts of Tomato brown rugose fruit virus

Questions

The ToBRFV Federal Import Order applies to imports of tomato (Solanum lycopersicum) and pepper (Capsicum spp.) seed lots and transplants from all countries and imports of tomato and pepper fruit entering the United States from Mexico, Canada, Israel, and the Netherlands. Obscured seeds (seeds that are coated, pelleted, or embedded in tape or another substrate that obscures visibility) and small seed lots are also subject to the Federal Import Order.

The Federal Order is effective November 22, 2019.

Only commercial shipments of tomato and pepper fruit may be imported into the United States. Commercial consignments entering from Mexico, Canada, Israel, and the Netherlands must either be:

  • Accompanied by a phytosanitary certificate issued by a National Plant Protection Organization of the country of origin containing the following additional declaration: “The Solanum lycopersicum and/or Capsicum spp. fruit have been inspected and been found to be free of symptoms of Tomato brown rugose fruit virus.”

OR

  • Accompanied by an inspection certification document issued by the grower or packer with the following language, in lieu of a phytosanitary certificate: “The Solanum lycopersicum and/or Capsicum spp. fruit have been inspected and been found free of symptoms of Tomato brown rugose fruit virus.” The inspection certificate must include the date of the inspection, the name, title, office, and address of the person issuing the inspection certificate, as well as the names and addresses of the grower and packinghouse.  

Any consignment of fresh tomato and pepper fruit arriving at a port of entry from Mexico, Canada, Israel, or the Netherlands without one of the documents required above will be refused entry and subject to re-export or destruction. 

Tomato and pepper fruits that are found in personal baggage will be confiscated and destroyed.

No. Fresh, cut fruit of tomato or pepper from any country is subject to the same import requirements as whole fruit. This has not been changed by this Federal Import Order. Many fresh, cut fruit and vegetables are approved for import under specific conditions as listed in the Miscellaneous and Processed Products Manual (Table 3-144 and Table 3-150). Tomato and pepper fruit are regulated as whole fruit (Table 3-149) and are subject to Federal Import Orders.

APHIS does not have specific qualifications or requirements, and any industry representative at the grower or packinghouse can complete the inspection certificate. The certificate needs to include all of the information listed here.

The fruit can be inspected in the field, greenhouse or packinghouse. The Inspection certification document must include who inspected the fruit and their affiliation.

 No, if the fruit is traveling under a transit permit, the fruit does not make entry into the United States and will not be inspected.

U.S. tomato and pepper fruit returning from Canada or Mexico that remains in its original packaging does not need inspection documentation. U.S. tomato and pepper fruit that has been repackaged or otherwise handled in Canada or Mexico must have inspection documentation from the country where it was repackaged or otherwise handled.

The packer in Canada can issue an industry inspection certificate signed by a Canadian industry representative.  The certificate should list the packer in Canada as well as the Mexican growers.

China, Greece, Turkey, Italy, Jordan, Mexico, the United Kingdom, Netherlands, Israel, and Palestine.

All current phytosanitary requirements must be met. In addition, peppers must be accompanied by an industry certificate that the fruit is free of ToBRFV.

All peppers need the industry certification document stating that they were inspected and found free of ToBRFV. Additionally, Manzano peppers have an irradiation requirement that must be met.

The Federal Import Order does not change Import Permit requirement for commercial consignments of tomato and/or pepper from certain countries. Import Permit requirements are listed in the Fruits and Vegetables Import Requirements (FAVIR) Online Database.

The Phytosanitary Certificate must state the country of origin, therefore, additional documentation to certify origin is not required.

Shipments of tomato or pepper seeds or propagative plant materials (including plants for planting, seeds, obscured seed, and cuttings) from all countries must be accompanied by a phytosanitary certificate or a re-export phytosanitary certificate with an additional declaration certifying that the lots fulfill the following requirements prior to importation into the United States and territories:

  • The Solanum lycopersicum and/or Capsicum spp. plants for planting or seeds originated from a country certified free from Tomato brown rugose fruit virus, as established by the national plant protection organizations of that country;

OR

  • A representative sample of the Solanum lycopersicum and/or Capsicum spp. plants for planting or seed lot has been officially tested and found free of Tomato brown rugose fruit virus.

Shipments of tomato or pepper seeds or propagative plant material without the required documentation will be refused entry into the United States. Shipments that left the exporting country before the publication of the Federal Import Order on November 15, 2019, will be evaluated upon arrival in the United States and samples may be taken to ensure they are free of the virus.


Small lots of tomato and pepper seed originating from a single mother plant or a single breeder line intended for breeding purposes and not for immediate commercial sale may be imported from all countries with a phytosanitary certificate with the following additional declaration: 

  • All mother plants of Solanum lycopersicum and/or Capsicum spp. from which the seed lot originated have been officially tested no more than 10 days prior to fruit harvest and found free of Tomato brown rugose fruit virus.

APHIS defines small lots of seed as a maximum of 50 seeds of 1 taxon (such as a genus, species, or cultivar) per seed packet or a maximum weight not to exceed 10 grams of seed of 1 taxon per seed packet. There may be a maximum of 50 seed packets per shipment. 

Small lots may also be imported under a PPQ-588 Controlled Import Permit. For more information, see APHIS’ Plant and Plant Products Page.

No, a Phytosanitary Certificate is required. This Federal Import Order imposes new regulatory requirements on all tomato and pepper propagative material, including plants grown in approved GCP facilities.

APHIS requires an official phytosanitary certificate issued by the National Plant Protection Organization (NPPO) of the exporting country. The certificate must include a statement indicating the materials are free from ToBRFV, as stated in the Federal Import Order. APHIS will not accept third party laboratory testing for ToBRFV in lieu of a phytosanitary certificate with the required statement from the exporting country. Please contact the NPPO of the exporting country to determine their requirements for issuing the phytosanitary certificate with the required statement.

Commercial consignments of tomato and/or pepper seeds do not need a permit. They must be accompanied by an official phytosanitary certificate with the required statement issued by the exporting country’s NPPO, as stated in the Federal Import Order.

No, a Phytosanitary Certificate is required. This Federal Import Order imposes new regulatory requirements on all tomato and pepper seed. However, a Seed Analysis Certificate or Seed Export Label may still be required to certify the seed lot has been sampled for Federal Noxious Weed seeds according to the U.S. Federal Seeds Act (FSA, 7 CFR 319.61).

"Officially tested" indicates that the seed or plants have been tested by the NPPO or their recognized designee.

"Representative sample" will be determined by the NPPO and will be based on the testing method used.

As noted elsewhere, the national plant protection organization of the exporting country must determine how they wish to satisfy the testing requirement for the phytosanitary certificate. PPQ has evaluated or is evaluating several PCR-based protocols to detect ToBRFV in seeds. In our lab and other laboratories, these protocols have successfully detected ToBRFV in seeds.

Primers / Reference
Comment
ToBRFV-F, 5’-GAAGTCCCGATGTCTGTAAGG-3’
ToBRFV-R, 5’-GTGCCTACGGATGTGTATGA-3’

Reference:
K.S. Ling, et al. 2019 First Report of Tomato brown rugose fruit virus infecting greenhouse tomato in the U.S. and Mexico.
https://doi.org/10.1094/PDIS-11-18-1959-PDN
PPQ has evaluated this protocol (end-point RT-PCR) and has used it successfully for virus detection in seeds, plant and fruit samples. PCR product size: 842bp. Product can be used for direct sequencing for confirmatory diagnostics.
ToBRFV-F 5’-AATGTCCATGTTTGTTACGCC-3’
ToBRFV-R 5’-CGAATGTGATTTAAAACTGTGAAT-3’

Reference:
Alkowni, A., et al. 2019. Molecular identification of tomato brown rugose fruit virus in tomato in Palestine. Journal of Plant Pathology.
https://doi.org/10.1007/s42161-019-00240-7

Upon further evaluation, PPQ has determined that this RT-PCR is less sensitive than coat protein (CP) gene based assays. Therefore PPQ is not recommending this protocol for ToBRFV detection.
CaTa28 Fw 5' -GGTGGTGTCAGTGTCTGTTT- 3'
CaTa28 Pr 5' 6FAM -AGAGAATGGAGAGAGCGGACGAGG- BHQ1 3'
CaTa28 Rv 5' -GCGTCCTTGGTAGTGATGTT -3'

Reference:
ISHI-Veg 2019. Detection of Infectious Tomato brown rugose fruit virus (ToBRFV) in Tomato and Pepper Seed.
https://www.worldseed.org/wp-content/uploads/2019/09/Pepper-ToBRFV_2019.09.pdf
PPQ is currently evaluating this protocol.
CSPtbrfv101 Fw 5' - CATTTGAAAGTGCATCCGGTT T - 3'
CSPtbrfv101 Pr 5' VIC -ATGGTCCTCTGCACCTGCATCTTGAGA - BHQ1 3'
CSPtbrfv101 Rv 5' - GTACCACGTGTGTTTGCAGAC A - 3'

Reference:
ISHI-Veg 2019. Detection of Infectious Tomato brown rugose fruit virus (ToBRFV) in Tomato and Pepper Seed.
https://www.worldseed.org/wp-content/uploads/2019/09/Pepper-ToBRFV_2019.09.pdf
PPQ is currently evaluating this protocol.

The third country will need to issue a re-export certificate with the required additional declaration after testing the propagative material.

Tomato or pepper seed imported for diagnostic purposes require a PPQ-526 permit “Application and Permit to Move Live Plant Pests or Noxious Weeds.” A phytosanitary certificate is not required for seed imported under a PPQ-526 permit. For more information, see APHIS’ Organism and Pest Permits Page.

Shipments of tomato or pepper seeds imported for research, developmental, or therapeutic purposes (for example, seeds imported for germination tests or variety trials) require a PPQ-588 Controlled Import Permit. A phytosanitary certificate is not required for seed imported under a PPQ-588 permit. For more information, see APHIS’ Plant and Plant Products Page.

No. Tomato and pepper seeds are no longer eligible for Obscured Seed Permits. Obscured seeds of tomato or pepper seeds are prohibited entry.

No. Shipments must be accompanied by a phytosanitary certificate that includes the required statement upon arrival at the port of entry.

To avoid potential delays and/or refusal, APHIS recommends that tomato or pepper seed shipments are separated from other species of seeds.

If boxes packed in Mexico are co-mingled with boxes packed in Canada, two certificates are required.  One certificate would be issued and signed by a Mexican industry representative for the fruit grown AND packed in Mexico.  A second certificate would be issued and signed by a Canadian industry representative for the fruit grown AND packed in Canada. 

ToBRFV can cause severe fruit loss in tomatoes and peppers. On pepper, it causes bubbling and mosaic patterns on leaves, while on tomato foliage it causes mosaic patterns and a “fern leaf” symptom. Infected fruits of both hosts are smaller, discolored, and may have rough, dead patches on the surface (see photos). Infected tomato fruits can be unmarketable or reduced in quality. Necrosis can occur on susceptible pepper fruit.

Fruit showing ToBRFV symptoms. (Figures 1 and 2: Luria, et al., 2017 https://doi.org/10.1371/journal.pone.0170429.g001); Figure 3: Alkowni, et al., 2019 https://www.researchgate.net/publication/330722102)

ToBRFV is transmitted through infected propagative plant parts (seeds, plants for planting, grafts, and cuttings), and spreads locally by contact (direct plant to plant contact, contaminated tools, hands, or clothing). ToBRFV can remain viable in seeds, plants debris and contaminated soil for months.

No, ToBRFV does not pose a health risk to people or animals.

ToBRFV-infected fruit is safe to eat. However, if you discard the fruit, throw it in the garbage. Do not put suspicious fruit in your backyard compost pile as seeds in the fruit could sprout into an infected plant.

We are using immunostrips at the ports of entry to test symptomatic tomato and pepper fruit for the genus Tobamovirus, which is actionable in the United States. Fruit that tests positive will be denied entry into the United States.

CBP will be disposing fruit via deep burial, steam sterilization, or InSinkErater.

The inspection has to occur between harvest and entry into the United States. If the fruit originated from a third country, then documentation of inspection from the originating country is also required.

Yes if the fruit on the load was inspected by the same person.  Multiple packinghouses and growers can be listed on the same certificate.

Yes if the fruit on the load was inspected by the same person.  Multiple packinghouses and growers can be listed on the same certificate.

No, each load must have its own certificate.

Each entry into the United States must be accompanied by its own industry certificate.

No.  Required documentation will be retained by Customs and Border Protection

Yes, the Federal Order will be effective and those shipments will require the correct documentation.

The shipment will be held while confirmation is obtained from an APHIS identifier. Shipper will have the option to re-export in lieu of an identification, destroy, or remain on hold pending confirmation.

Commodities not subject to the Federal order may be separated and allowed entry.

No.  Fruit found to be positive for ToBRFV after inspection will be considered not enterable and must be returned to origin.

Pending a regulatory decision on the shipment, the product will not be allowed entry in the United States.  Importers may choose not to wait for a regulatory decision or return to origin.

CBP will be disposing fruit via deep burial or InSinkErater into approved sewage systems.

Yes.  CPB will only accept an original certificate.


Complementary Content
${loading}