Shipments of tomato or pepper seeds or propagative plant materials (including plants for planting, seeds, obscured seed, and cuttings) from all countries must be accompanied by a phytosanitary certificate or a re-export phytosanitary certificate with an additional declaration certifying that the lots fulfill the following requirements prior to importation into the United States and territories:
OR
A representative sample of the Solanum lycopersicum and/or Capsicum spp. plants for planting or seed lot has been officially tested and found free of Tomato brown rugose fruit virus.Shipments of tomato or pepper seeds or propagative plant material without the required documentation will be refused entry into the United States. Shipments that left the exporting country before the publication of the Import Federal Order will be evaluated upon arrival in the United States and samples may be taken to ensure they are free of the virus.
Small lots of tomato and pepper seed originating from a single mother plant or a single breeder line intended for breeding purposes and not for immediate commercial sale may be imported from all countries with a phytosanitary certificate with the following additional declaration:
APHIS defines small lots of seed as a maximum of 50 seeds of 1 taxon (such as a genus, species, or cultivar) per seed packet or a maximum weight not to exceed 10 grams of seed of 1 taxon per seed packet. There may be a maximum of 50 seed packets per shipment.
Small lots may also be imported under a PPQ-588 Controlled Import Permit. For more information, see APHIS’ Plant and Plant Products Page.
No, a phytosanitary certificate is required. This Import Federal Order imposes new regulatory requirements on all tomato and pepper propagative material, including plants grown in approved GCP facilities.
APHIS requires an official phytosanitary certificate issued by the National Plant Protection Organization (NPPO) of the exporting country. The certificate must include a statement indicating the materials are free from ToBRFV, as stated in the Import Federal Order. APHIS will not accept third party laboratory testing for ToBRFV in lieu of a phytosanitary certificate with the required statement from the exporting country. Please contact the NPPO of the exporting country to determine their requirements for issuing the phytosanitary certificate with the required statement.
Commercial consignments of tomato and/or pepper seeds do not need a permit. They must be accompanied by an official phytosanitary certificate with the required statement issued by the exporting country’s NPPO, as stated in the Import Federal Order.
No, a phytosanitary certificate is required. This Import Federal Order imposes new regulatory requirements on all tomato and pepper seed. However, a Seed Analysis Certificate or Seed Export Label may still be required to certify the seed lot has been sampled for Federal Noxious Weed seeds according to the U.S. Federal Seeds Act (FSA, 7 CFR 319.61).
"Representative sample" will be determined by the NPPO and will be based on the testing method used.
As noted elsewhere, the National Plant Protection Organization (NPPO) of the exporting country must determine how they wish to satisfy the testing requirement for the phytosanitary certificate. APHIS has evaluated or is evaluating several PCR-based protocols to detect ToBRFV in seeds. In our lab and other laboratories, these protocols have successfully detected ToBRFV in seeds.
Primers / Reference
|
Comment
|
---|---|
ToBRFV-F, 5’-GAAGTCCCGATGTCTGTAAGG-3’ ToBRFV-R, 5’-GTGCCTACGGATGTGTATGA-3’ Reference: K.S. Ling, et al. 2019 First Report of Tomato brown rugose fruit virus infecting greenhouse tomato in the U.S. and Mexico. https://doi.org/10.1094/PDIS-11-18-1959-PDN |
APHIS has evaluated this protocol (end-point RT-PCR) and has used it successfully for virus detection in seeds, plant and fruit samples. PCR product size: 842bp. Product can be used for direct sequencing for confirmatory diagnostics.
|
ToBRFV-F 5’-AATGTCCATGTTTGTTACGCC-3’
ToBRFV-R 5’-CGAATGTGATTTAAAACTGTGAAT-3’ Reference: Alkowni, A., et al. 2019. Molecular identification of tomato brown rugose fruit virus in tomato in Palestine. Journal of Plant Pathology. https://doi.org/10.1007/s42161-019-00240-7 |
Upon further evaluation, PPQ has determined that this RT-PCR is less sensitive than coat protein (CP) gene based assays. Therefore APHIS is not recommending this protocol for ToBRFV detection. |
CaTa28 Fw 5' -GGTGGTGTCAGTGTCTGTTT- 3'
CaTa28 Pr 5' 6FAM -AGAGAATGGAGAGAGCGGACGAGG- BHQ1 3' CaTa28 Rv 5' -GCGTCCTTGGTAGTGATGTT -3' Reference: ISHI-Veg 2019. Detection of Infectious Tomato brown rugose fruit virus (ToBRFV) in Tomato and Pepper Seed. https://www.worldseed.org/wp-content/uploads/2019/09/Tomato-ToBRFV_2019.09.pdf |
APHIS is currently evaluating this protocol. |
CSPtbrfv101 Fw 5' - CATTTGAAAGTGCATCCGGTT T - 3'
CSPtbrfv101 Pr 5' VIC -ATGGTCCTCTGCACCTGCATCTTGAGA - BHQ1 3' CSPtbrfv101 Rv 5' - GTACCACGTGTGTTTGCAGAC A - 3' Reference: ISHI-Veg 2019. Detection of Infectious Tomato brown rugose fruit virus (ToBRFV) in Tomato and Pepper Seed. https://www.worldseed.org/wp-content/uploads/2019/09/Tomato-ToBRFV_2019.09.pdf |
APHIS is currently evaluating this protocol. |
The country where the seed is located will need to issue a re-export certificate with the required additional declaration after testing the propagative material.
Tomato or pepper seed imported for diagnostic purposes require a PPQ-526 permit “Application and Permit to Move Live Plant Pests or Noxious Weeds.” A phytosanitary certificate is not required for seed imported under a PPQ-526 permit. For more information, see APHIS’ Organism and Pest Permits Page.
Shipments of tomato or pepper seeds imported for research, developmental, or therapeutic purposes (for example, seeds imported for germination tests or variety trials) require a PPQ-588 Controlled Import Permit. A phytosanitary certificate is not required for seed imported under a PPQ-588 permit. For more information, see APHIS’ Plant and Plant Products Page.
Yes, you can continue to use “PPQ 587 Obscured Seed Permit” to import obscured tomato or pepper seed. However, you must still fulfill the requirements outlined in the Import Federal Order by accompanying the permit with a phytosanitary certificate that includes an additional declaration as stated in the Import Federal Order.
No. Shipments must be accompanied by a phytosanitary certificate that includes the required statement upon arrival at the port of entry.
To avoid potential delays and/or refusal, APHIS recommends that tomato or pepper seed shipments are separated from other species of seeds.